SeqAn3 3.3.0-rc.1
The Modern C++ library for sequence analysis.
SAM File

Provides files and formats for handling read mapping data. More...

+ Collaboration diagram for SAM File:

Classes

struct  seqan3::detail::access_restrictor_fn
 A functor that always throws when calling operator() (needed for the alignment "dummy" sequence). More...
 
class  seqan3::format_bam
 The BAM format. More...
 
class  seqan3::format_sam
 The SAM format (tag). More...
 
class  seqan3::detail::format_sam_base
 The alignment base format. More...
 
struct  seqan3::ref_info_not_given
 Type tag which indicates that no reference information has been passed to the SAM file on construction. More...
 
class  seqan3::sam_file_header< ref_ids_type >
 Stores the header information of SAM/BAM files. More...
 
class  seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >
 A class for reading SAM files, both SAM and its binary representation BAM are supported. More...
 
struct  seqan3::sam_file_input_default_traits< ref_sequences_t, ref_ids_t >
 The default traits for seqan3::sam_file_input. More...
 
interface  seqan3::sam_file_input_format< t >
 The generic concept for alignment file input formats. More...
 
struct  seqan3::detail::sam_file_input_format_exposer< format_type >
 Internal class used to expose the actual format interface to read SAM records from the file. More...
 
struct  seqan3::sam_file_input_options< sequence_legal_alphabet >
 The options type defines various option members that influence the behaviour of all or some formats. More...
 
interface  sam_file_input_traits
 The requirements a traits_type for seqan3::sam_file_input must meet. More...
 
class  seqan3::sam_file_output< selected_field_ids_, valid_formats_, ref_ids_type >
 A class for writing SAM files, both SAM and its binary representation BAM are supported. More...
 
interface  seqan3::sam_file_output_format< t >
 The generic concept for alignment file out formats. More...
 
struct  seqan3::detail::sam_file_output_format_exposer< format_type >
 Internal class used to expose the actual format interface to write SAM/BAM records into the file. More...
 
struct  seqan3::sam_file_output_options
 The options type defines various option members that influence the behavior of all or some formats. More...
 
class  seqan3::sam_record< field_types, field_ids >
 The record type of seqan3::sam_file_input. More...
 
class  seqan3::sam_tag_dictionary
 The SAM tag dictionary class that stores all optional SAM fields. More...
 
struct  seqan3::sam_tag_type< tag_value >
 The generic base class. More...
 
struct  seqan3::detail::view_equality_fn
 Comparator that is able two compare two views. More...
 

Typedefs

using seqan3::detail::sam_tag_variant = std::variant< char, int32_t, float, std::string, std::vector< std::byte >, std::vector< int8_t >, std::vector< uint8_t >, std::vector< int16_t >, std::vector< uint16_t >, std::vector< int32_t >, std::vector< uint32_t >, std::vector< float > >
 std::variant of allowed types for optional tag fields of the SAM format.
 

Enumerations

enum class  seqan3::sam_flag : uint16_t {
  seqan3::sam_flag::none = 0 , seqan3::sam_flag::paired = 0x1 , seqan3::sam_flag::proper_pair = 0x2 , seqan3::sam_flag::unmapped = 0x4 ,
  seqan3::sam_flag::mate_unmapped = 0x8 , seqan3::sam_flag::on_reverse_strand = 0x10 , seqan3::sam_flag::mate_on_reverse_strand = 0x20 , seqan3::sam_flag::first_in_pair = 0x40 ,
  seqan3::sam_flag::second_in_pair = 0x80 , seqan3::sam_flag::secondary_alignment = 0x100 , seqan3::sam_flag::failed_filter = 0x200 , seqan3::sam_flag::duplicate = 0x400 ,
  seqan3::sam_flag::supplementary_alignment = 0x800
}
 An enum flag that describes the properties of an aligned read (given as a SAM record). More...
 

Functions

template<seqan3::aligned_sequence ref_seq_type, seqan3::aligned_sequence query_seq_type>
std::string seqan3::detail::get_cigar_string (ref_seq_type &&ref_seq, query_seq_type &&query_seq, uint32_t const query_start_pos=0, uint32_t const query_end_pos=0, bool const extended_cigar=false)
 Transforms an alignment represented by two seqan3::aligned_sequence's into the corresponding cigar string. More...
 
std::string seqan3::detail::get_cigar_string (std::vector< cigar > const &cigar_vector)
 Transforms a vector of cigar elements into a string representation. More...
 
template<typename cigar_input_type >
constexpr std::tuple< std::vector< cigar >, int32_t, int32_t > seqan3::detail::parse_cigar (cigar_input_type &&cigar_input)
 Parses a cigar string into a vector of operation-count pairs (e.g. (M, 3)). More...
 
void seqan3::detail::update_alignment_lengths (int32_t &ref_length, int32_t &seq_length, char const cigar_operation, uint32_t const cigar_count)
 Updates the sequence lengths by cigar_count depending on the cigar operation op. More...
 

Variables

template<>
constexpr bool seqan3::add_enum_bitwise_operators< sam_flag > = true
 Enables bitwise operations for seqan3::sam_flags. More...
 
template<typename t >
constexpr bool seqan3::detail::is_type_list_of_sam_file_input_formats_v = false
 Auxiliary value metafuncton that checks whether a type is a seqan3::type_list and all types meet seqan3::sam_file_input_format [default is false]. More...
 
template<typename... ts>
constexpr bool seqan3::detail::is_type_list_of_sam_file_input_formats_v< type_list< ts... > > = (sam_file_input_format<ts> && ...)
 Auxiliary value metafuncton that checks whether a type is a seqan3::type_list and all types meet seqan3::sam_file_input_format [overload]. More...
 
template<typename t >
constexpr bool seqan3::detail::is_type_list_of_sam_file_output_formats_v = false
 Auxiliary value metafuncton that checks whether a type is a seqan3::type_list and all types meet seqan3::sam_file_output_format [default is false]. More...
 
template<typename... ts>
constexpr bool seqan3::detail::is_type_list_of_sam_file_output_formats_v< type_list< ts... > > = (sam_file_output_format<ts> && ...)
 Auxiliary value metafuncton that checks whether a type is a seqan3::type_list and all types meet seqan3::sam_file_output_format [overload]. More...
 
constexpr char seqan3::detail::sam_tag_type_char [12] = {'A', 'i', 'f', 'Z', 'H', 'B', 'B', 'B', 'B', 'B', 'B', 'B'}
 Each SAM tag type char identifier. Index corresponds to the seqan3::detail::sam_tag_variant types.
 
constexpr char seqan3::detail::sam_tag_type_char_extra [12] = {'\0', '\0', '\0', '\0', '\0', 'c', 'C', 's', 'S', 'i', 'I', 'f'}
 Each types SAM tag type extra char id. Index corresponds to the seqan3::detail::sam_tag_variant types.
 

Other literals

template<typename char_t , char_t... s>
constexpr uint16_t seqan3::literals::operator""_tag ()
 The SAM tag literal, such that tags can be used in constant expressions. More...
 
template<typename char_t , char_t... s>
constexpr uint16_t operator""_tag ()
 The SAM tag literal, such that tags can be used in constant expressions. More...
 

Detailed Description

Provides files and formats for handling read mapping data.

Introduction

SAM/BAM files are primarily used to store pairwise alignments of read mapping data.

Note
For a step-by-step guide take a look at our tutorial: SAM Input and Output in SeqAn.

The SAM file abstraction supports reading 11 different fields:

  1. seqan3::field::seq
  2. seqan3::field::id
  3. seqan3::field::offset
  4. seqan3::field::ref_id
  5. seqan3::field::ref_offset
  6. seqan3::field::cigar
  7. seqan3::field::mapq
  8. seqan3::field::qual
  9. seqan3::field::flag
  10. seqan3::field::mate
  11. seqan3::field::tags

There exists one more field for SAM files, the seqan3::field::header_ptr, but this field is mostly used internally. Please see the seqan3::sam_file_output::header member function for details on how to access the seqan3::sam_file_header of the file.

All of these fields are retrieved by default (and in that order).

Reading SAM files

Construction and specialisation

The seqan3::sam_file_input class comes with four constructors: One for construction from a file name, one for construction from an existing stream and a known format and both of the former with or without additional reference information. Constructing from a file name automatically picks the format based on the extension of the file name. Constructing from a stream can be used if you have a non-file stream, like std::cin or std::istringstream. It also comes in handy, if you cannot use file-extension based detection, but know that your input file has a certain format.

Passing reference information, e.g. comes in handy once you want to convert the CIGAR string, read from your file, into an actual alignment. This will be covered in the section Transforming the CIGAR information into an actual alignment.In most cases the template parameters are deduced automatically:
#include <filesystem>
#include <sstream>
auto sam_file_raw = R"(@HD VN:1.6 SO:coordinate GO:none
@SQ SN:ref LN:45
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *
r003 0 ref 29 30 5S6M * 0 0 GCCTAAGCTAA * SA:Z:ref,29,-,6H5M,17,0;
r003 2064 ref 29 17 6H5M * 0 0 TAGGC * SA:Z:ref,9,+,5S6M,30,1;
r001 147 ref 237 30 9M = 7 -39 CAGCGGCAT * NM:i:1
)";
int main()
{
// Create the temporary file.
auto tmp_file = std::filesystem::temp_directory_path() / "my.sam";
std::ofstream tmp_stream{tmp_file};
tmp_stream << sam_file_raw;
tmp_stream.close();
seqan3::sam_file_input fin{tmp_file}; // SAM format assumed, regular std::ifstream taken as stream
}
A class for reading SAM files, both SAM and its binary representation BAM are supported.
Definition: sam_file/input.hpp:244
T close(T... args)
T remove(T... args)
Provides seqan3::sam_file_input and corresponding traits classes.
T temp_directory_path(T... args)
Reading from a std::istringstream:
#include <sstream>
auto input = R"(@HD VN:1.6 SO:coordinate
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *)";
int main()
{
// ^ no need to specify the template arguments
}
The SAM format (tag).
Definition: format_sam.hpp:108
Note that this is not the same as writing sam_file_input<> (with angle brackets). In the latter case they are explicitly set to their default values, in the former case automatic deduction happens which chooses different parameters depending on the constructor arguments. For opening from file, sam_file_input<> would have also worked, but for opening from stream it would not have.

You can define your own traits type to further customise the types used by and returned by this class, see seqan3::sam_file_input_default_traits for more details. As mentioned above, specifying at least one template parameter yourself means that you loose automatic deduction. The following is equivalent to the automatic type deduction example with a stream from above:
#include <sstream>
auto input = R"(@HD VN:1.6 SO:coordinate
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *)";
int main()
{
// The default types; you can adjust this list if you don't want to read all this data.
using default_fields = seqan3::fields<seqan3::field::seq,
// The expected format:
default_fields,
// Which formats are allowed:
sam_file_input_t fin{std::istringstream{input}, seqan3::format_sam{}};
}
@ flag
The alignment flag (bit information), uint16_t value.
@ ref_offset
Sequence (seqan3::field::ref_seq) relative start position (0-based), unsigned value.
@ cigar
The cigar vector (std::vector<seqan3::cigar>) representing the alignment in SAM/BAM format.
@ mapq
The mapping quality of the seqan3::field::seq alignment, usually a Phred-scaled score.
@ offset
Sequence (seqan3::field::seq) relative start position (0-based), unsigned value.
@ mate
The mate pair information given as a std::tuple of reference name, offset and template length.
@ header_ptr
A pointer to the seqan3::sam_file_header object storing header information.
@ ref_id
The identifier of the (reference) sequence that seqan3::field::seq was aligned to.
@ id
The identifier, usually a string.
@ tags
The optional tags in the SAM format, stored in a dictionary.
@ seq
The "sequence", usually a range of nucleotides or amino acids.
@ qual
The qualities, usually in Phred score notation.
A class template that holds a choice of seqan3::field.
Definition: record.hpp:128
Type that contains multiple types.
Definition: type_list.hpp:29
Provides seqan3::type_list.

Reading record-wise

You can iterate over this file record-wise:
#include <sstream>
auto sam_file_raw = R"(@HD VN:1.6 SO:coordinate GO:none
@SQ SN:ref LN:45
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *
r003 0 ref 29 30 5S6M * 0 0 GCCTAAGCTAA * SA:Z:ref,29,-,6H5M,17,0;
r003 2064 ref 29 17 6H5M * 0 0 TAGGC * SA:Z:ref,9,+,5S6M,30,1;
r001 147 ref 237 30 9M = 7 -39 CAGCGGCAT * NM:i:1
)";
int main()
{
for (auto & rec : fin)
{
seqan3::debug_stream << "id: " << rec.id() << '\n';
seqan3::debug_stream << "read sequence: " << rec.sequence() << '\n';
seqan3::debug_stream << "mapping position: " << rec.reference_position() << '\n';
seqan3::debug_stream << "mapping quality: " << rec.mapping_quality() << '\n';
// there are more fields read on default
}
}
Provides seqan3::debug_stream and related types.
debug_stream_type debug_stream
A global instance of seqan3::debug_stream_type.
Definition: debug_stream.hpp:37
In the above example, rec has the type seqan3::sam_file_input::record_type which is a specialisation of seqan3::record and behaves like a std::tuple (that's why we can access it via get). Instead of using the seqan3::field based interface on the record, you could also use std::get<0> or even std::get<dna4_vector> to retrieve the sequence, but it is not recommended, because it is more error-prone.
Note
It is important to write auto & and not just auto, otherwise you will copy the record on every iteration. Since the buffer gets "refilled" on every iteration, you can also move the data out of the record if you want to store it somewhere without copying:
#include <sstream>
#include <utility>
#include <vector>
auto sam_file_raw = R"(@HD VN:1.6 SO:coordinate GO:none
@SQ SN:ref LN:45
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *
r003 0 ref 29 30 5S6M * 0 0 GCCTAAGCTAA * SA:Z:ref,29,-,6H5M,17,0;
r003 2064 ref 29 17 6H5M * 0 0 TAGGC * SA:Z:ref,9,+,5S6M,30,1;
r001 147 ref 237 30 9M = 7 -39 CAGCGGCAT * NM:i:1
)";
int main()
{
using record_type = typename decltype(fin)::record_type;
std::vector<record_type> records{}; // store all my records in a vector
for (auto & rec : fin)
records.push_back(std::move(rec));
}
T push_back(T... args)

Reading record-wise (custom fields)

If you want to skip specific fields from the record you can pass a non-empty fields trait object to the seqan3::sam_file_input constructor to select the fields that should be read from the input. For example, you may only be interested in the mapping flag and mapping quality of your SAM data to get some statistics. The following snippets demonstrate the usage of such a fields trait object.
#include <sstream>
auto sam_file_raw = R"(@HD VN:1.6 SO:coordinate GO:none
@SQ SN:ref LN:45
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *
r003 0 ref 29 30 5S6M * 0 0 GCCTAAGCTAA * SA:Z:ref,29,-,6H5M,17,0;
r003 2064 ref 29 17 6H5M * 0 0 TAGGC * SA:Z:ref,9,+,5S6M,30,1;
r001 147 ref 237 30 9M = 7 -39 CAGCGGCAT * NM:i:1
)";
int main()
{
for (auto & rec : fin)
{
seqan3::debug_stream << "flag: " << rec.flag() << '\n';
seqan3::debug_stream << "mapping quality: " << rec.mapping_quality() << '\n';
}
}
When reading a file, all fields not present in the file (but requested implicitly or via the selected_field_ids parameter) are ignored and the respective value in the record stays empty.

Reading record-wise (decomposed records)

Instead of using get on the record, you can also use structured bindings to decompose the record into its elements. Considering the example of reading only the flag and mapping quality like before you can also write:
#include <sstream>
auto sam_file_raw = R"(@HD VN:1.6 SO:coordinate GO:none
@SQ SN:ref LN:45
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *
r003 0 ref 29 30 5S6M * 0 0 GCCTAAGCTAA * SA:Z:ref,29,-,6H5M,17,0;
r003 2064 ref 29 17 6H5M * 0 0 TAGGC * SA:Z:ref,9,+,5S6M,30,1;
r001 147 ref 237 30 9M = 7 -39 CAGCGGCAT * NM:i:1
)";
int main()
{
for (auto & [flag, mapq] : fin) // the order is the same as specified in fields!
{
seqan3::debug_stream << "flag: " << flag << '\n';
seqan3::debug_stream << "mapping quality: " << mapq << '\n';
}
}
In this case you immediately get the two elements of the tuple: flag of seqan3::sam_file_input::flag_type and mapq of seqan3::sam_file_input::mapq_type.
Note
But beware: with structured bindings you do need to get the order of elements correctly!

Transforming the CIGAR information into an actual alignment

In SeqAn, we represent an alignment as a tuple of two seqan3::aligned_sequences.The conversion from a CIGAR string to an alignment can be done with the function seqan3::alignment_from_cigar. You need to pass the reference sequence with the position the read was aligned to and the read sequence. All of it is already in the record when reading a SAM file:
using namespace seqan3::literals;
auto sam_file_raw = R"(@HD VN:1.6
@SQ SN:ref LN:34
read1 41 ref 1 61 1S1M1D1M1I ref 10 300 ACGT !##$ AS:i:2 NM:i:7
read2 42 ref 2 62 1H7M1D1M1S2H ref 10 300 AGGCTGNAG !##$&'()* xy:B:S,3,4,5
read3 43 ref 3 63 1S1M1P1M1I1M1I1D1M1S ref 10 300 GGAGTATA !!*+,-./
)";
int main()
{
// The reference sequence might be read from a different file.
seqan3::dna5_vector reference = "ACTGATCGAGAGGATCTAGAGGAGATCGTAGGAC"_dna5;
// You will probably read it from a file, e.g., like this:
// seqan3::sam_file_input fin{"test.sam"};
for (auto && rec : fin)
{
auto alignment =
alignment_from_cigar(rec.cigar_sequence(), reference, rec.reference_position().value(), rec.sequence());
}
// prints:
// (ACT-,C-GT)
// (CTGATCGAG,AGGCTGN-A)
// (T-G-A-TC,G-AGTA-T)
}
Provides the function seqan3::alignment_from_cigar.
auto alignment_from_cigar(std::vector< cigar > const &cigar_vector, reference_type const &reference, uint32_t const zero_based_reference_start_position, sequence_type const &query)
Construct an alignment from a CIGAR string and the corresponding sequences.
Definition: alignment_from_cigar.hpp:83
@ alignment
The (pairwise) alignment stored in an object that models seqan3::detail::pairwise_alignment.
typedef IMPLEMENTATION_DEFINED reference
The type of a reference to an entry in the matrix.
Meta-header for the IO / SAM File submodule .
The SeqAn namespace for literals.
The code will print the following:
(ACT-,C-GT)
(CTGATCGAG,AGGCTGN-A)
(T-G-A-TC,G-AGTA-T)

Views on files

Since SeqAn files are ranges, you can also create views over files. A useful example is to filter the records based on certain criteria, e.g. minimum length of the sequence field:
#include <ranges>
#include <sstream>
auto sam_file_raw = R"(@HD VN:1.6 SO:coordinate GO:none
@SQ SN:ref LN:45
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *
r003 0 ref 29 30 5S6M * 0 0 GCCTAAGCTAA * SA:Z:ref,29,-,6H5M,17,0;
r003 2064 ref 29 17 6H5M * 0 0 TAGGC * SA:Z:ref,9,+,5S6M,30,1;
r001 147 ref 237 30 9M = 7 -39 CAGCGGCAT * NM:i:1
)";
int main()
{
auto minimum_length10_filter = std::views::filter(
[](auto const & rec)
{
return std::ranges::size(rec.sequence()) >= 10;
});
for (auto & rec : fin | minimum_length10_filter) // only records with sequence length >= 10 will "appear"
seqan3::debug_stream << rec.id() << '\n';
}
constexpr size_t size
The size of a type pack.
Definition: type_pack/traits.hpp:146

End of file

You can check whether a file is at its end by comparing begin() and end() (if they are the same, the file is at its end).

Formats

We currently support reading the following formats:

Writing SAM files

Construction and specialisation

The seqan3::sam_file_output class comes with two constructors, one for construction from a file name and one for construction from an existing stream and a known format. The first one automatically picks the format based on the extension of the file name. The second can be used if you have a non-file stream, like std::cout or std::ostringstream, that you want to read from and/or if you cannot use file-extension based detection, but know that your output file has a certain format.

In most cases the template parameters are deduced completely automatically:
#include <filesystem>
int main()
{
auto tmp_file = std::filesystem::temp_directory_path() / "my.sam";
seqan3::sam_file_output fout{tmp_file}; // SAM format detected, std::ofstream opened for file
}
A class for writing SAM files, both SAM and its binary representation BAM are supported.
Definition: io/sam_file/output.hpp:75
Provides seqan3::sam_file_output and corresponding traits classes.
Writing to std::cout:Note that this is not the same as writing sam_file_output<> (with angle brackets). In the latter case they are explicitly set to their default values, in the former case automatic deduction happens which chooses different parameters depending on the constructor arguments. For opening from file, sam_file_output<> would have also worked, but for opening from stream it would not have.

Writing record-wise

#include <sstream>
#include <string>
#include <vector>
int main()
{
std::string read_id;
// ... e.g. compute and alignment
using alignment_type =
alignment_type dummy_alignment{}; // an empty dummy alignment
// the record type specifies the fields we want to write
// initialize record
record_type rec{read, ref_id, dummy_alignment};
// Write the record
fout.push_back(rec);
// same as
fout.push_back(record_type{read, ref_id, dummy_alignment});
// as all our fields are empty so this would print an
}
Provides seqan3::dna5, container aliases and string literals.
The class template that file records are based on; behaves like a std::tuple.
Definition: record.hpp:192
The easiest way to write to a SAM/BAM file is to use the push_back() member functions. These work similarly to how they work on a std::vector. You may also use a tuple like interface or the emplace_back() function but this is not recommended since one would have to keep track of the correct order of many fields (14 in total). For the record based interface using push_back() please also see the seqan3::record documentation on how to specify a record with the correct field and type lists.

You may also use the output file's iterator for writing, however, this rarely provides an advantage.

Writing record-wise (custom fields)

If you want to omit non-required parameter or change the order of the parameters, you can pass a non-empty fields trait object to the seqan3::sam_file_output constructor to select the fields that are used for interpreting the arguments.

The following snippet demonstrates the usage of such a field_traits object.
#include <filesystem>
#include <sstream>
#include <tuple>
int main()
{
// I only want to print the mapping position (field::ref_offset) and flag:
unsigned mapping_pos{1300};
// ...
fout.emplace_back(mapping_pos, flag); // note that the order the arguments is now different, because
// or: you specified that REF_OFFSET should be first
fout.push_back(std::tie(mapping_pos, flag));
}
sam_flag
An enum flag that describes the properties of an aligned read (given as a SAM record).
Definition: sam_flag.hpp:76
@ none
None of the flags below are set.
T tie(T... args)
A different way of passing custom fields to the file is to pass a seqan3::record – instead of a tuple – to push_back(). The seqan3::record clearly indicates which of its elements has which seqan3::field so the file will use that information instead of the template argument. This is especially handy when reading from one file and writing to another, because you don't have to configure the output file to match the input file, it will just work:
#include <filesystem>
#include <sstream>
auto sam_file_raw = R"(@HD VN:1.6 SO:coordinate GO:none
@SQ SN:ref LN:45
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *
r003 0 ref 29 30 5S6M * 0 0 GCCTAAGCTAA * SA:Z:ref,29,-,6H5M,17,0;
r003 2064 ref 29 17 6H5M * 0 0 TAGGC * SA:Z:ref,9,+,5S6M,30,1;
r001 147 ref 237 30 9M = 7 -39 CAGCGGCAT * NM:i:1
)";
int main()
{
// fin uses custom fields, fout uses the default fields.
// output doesn't have to match the configuration of the input
for (auto & r : fin)
fout.push_back(r); // copy all the records.
}
This will copy the seqan3::field::flag and seqan3::field::ref_offset value into the new output file.
Note
Note that the other SAM columns in the output file will have a default value, so unless you specify to read all SAM columns (see seqan3::format_sam) the output file will not be equal to the input file.

Writing record-wise in batches

You can write multiple records at once, by assigning to the file:
#include <sstream>
#include <string>
#include <tuple>
#include <vector>
int main()
{
using namespace seqan3::literals;
{"NATA"_dna5, "2nd"},
{"GATA"_dna5, "Third"}}; // a range of "records"
fout = range; // will iterate over the records and write them
// equivalent to:
range | fout;
}

File I/O pipelines

Record-wise writing in batches also works for writing from input files directly to output files, because input files are also input ranges in SeqAn:
#include <sstream>
auto sam_file_raw = R"(First 0 * 0 0 * * 0 0 ACGT *
2nd 0 * 0 0 * * 0 0 NATA *
Third 0 * 0 0 * * 0 0 GATA *
)";
int main()
{
// copying a file in one line:
// with seqan3::sam_file_output as a variable:
fout = fin;
// or in pipe notation:
}
This can be combined with file-based views to create I/O pipelines:
#include <ranges>
#include <sstream>
auto sam_file_raw = R"(@HD VN:1.6 SO:coordinate GO:none
@SQ SN:ref LN:45
r001 99 ref 7 30 * = 37 39 TTAGATAAAGGATACTG *
r003 0 ref 29 30 * * 0 0 GCCTAAGCTAA * SA:Z:ref,29,-,6H5M,17,0;
r003 2064 ref 29 17 * * 0 0 TAGGC * SA:Z:ref,9,+,5S6M,30,1;
r001 147 ref 237 30 * = 7 -39 CAGCGGCAT * NM:i:1
)";
int main()
{
auto input_file = seqan3::sam_file_input{std::istringstream{sam_file_raw}, seqan3::format_sam{}};
input_file | std::views::take(3) // take only the first 3 records
}
typename decltype(detail::split_after< i >(list_t{}))::first_type take
Return a seqan3::type_list of the first n types in the input type list.
Definition: type_list/traits.hpp:377

Formats

We currently support writing the following formats:

Enumeration Type Documentation

◆ sam_flag

enum class seqan3::sam_flag : uint16_t
strong

An enum flag that describes the properties of an aligned read (given as a SAM record).

See also
seqan3::enum_bitwise_operators enables combining enum values.

The SAM flag are bitwise flags, which means that each value corresponds to a specific bit that is set and that they can be combined and tested using binary operations. See this tutorial for an introduction on bitwise operations on enum flags.

Example:

#include <iostream>
#include <sstream>
auto sam_file_raw = R"(@HD VN:1.6 SO:coordinate GO:none
@SQ SN:ref LN:45
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG !!!!!!!!!!!!!!!!!
r003 0 ref 29 30 5S6M * 0 0 GCCTAAGCTAA !!!!!!!!!!! SA:Z:ref,29,-,6H5M,17,0;
r003 4 * 29 17 * * 0 0 TAGGC @@@@@ SA:Z:ref,9,+,5S6M,30,1;
r001 147 ref 237 30 9M = 7 -39 CAGCGGCAT !!!!!!!!! NM:i:1
)";
int main()
{
for (auto & rec : fin)
{
// Check if a certain flag value (bit) is set:
if (static_cast<bool>(rec.flag() & seqan3::sam_flag::unmapped))
std::cout << "Read " << rec.id() << " is unmapped\n";
if (rec.base_qualities()[0] < seqan3::assign_char_to('@', seqan3::phred42{})) // low quality
{
// Set a flag value (bit):
// Note that this does not affect other flag values (bits),
// e.g. `rec.flag() & seqan3::sam_flag::unmapped` may still be true
}
// Unset a flag value (bit):
rec.flag() &= ~seqan3::sam_flag::duplicate; // not marked as a duplicate anymore
}
}
Quality type for traditional Sanger and modern Illumina Phred scores..
Definition: phred42.hpp:47
constexpr auto assign_char_to
Assign a character to an alphabet object.
Definition: alphabet/concept.hpp:524
@ failed_filter
The read alignment failed a filter, e.g. quality controls.
@ unmapped
The read is not mapped to a reference (unaligned).
The main SeqAn3 namespace.
Definition: aligned_sequence_concept.hpp:29

Adapted from the SAM specifications are the following additional information to some flag values:

See also
https://broadinstitute.github.io/picard/explain-flags.html
Remarks
For a complete overview, take a look at SAM File
Enumerator
none 

None of the flags below are set.

paired 

The aligned read is paired (paired-end sequencing).

proper_pair 

The two aligned reads in a pair have a proper distance between each other.

unmapped 

The read is not mapped to a reference (unaligned).

mate_unmapped 

The mate of this read is not mapped to a reference (unaligned).

on_reverse_strand 

The read sequence has been reverse complemented before being mapped (aligned).

mate_on_reverse_strand 

The mate sequence has been reverse complemented before being mapped (aligned).

first_in_pair 

Indicates the ordering (see details in the seqan3::sam_flag description).

second_in_pair 

Indicates the ordering (see details in the seqan3::sam_flag description).

secondary_alignment 

This read alignment is an alternative (possibly suboptimal) to the primary.

failed_filter 

The read alignment failed a filter, e.g. quality controls.

duplicate 

The read is marked as a PCR duplicate or optical duplicate.

supplementary_alignment 

This sequence is part of a split alignment and is not the primary alignment.

Function Documentation

◆ get_cigar_string() [1/2]

template<seqan3::aligned_sequence ref_seq_type, seqan3::aligned_sequence query_seq_type>
std::string seqan3::detail::get_cigar_string ( ref_seq_type &&  ref_seq,
query_seq_type &&  query_seq,
uint32_t const  query_start_pos = 0,
uint32_t const  query_end_pos = 0,
bool const  extended_cigar = false 
)
inline

Transforms an alignment represented by two seqan3::aligned_sequence's into the corresponding cigar string.

Template Parameters
ref_seq_typeMust model seqan3::aligned_sequence.
query_seq_typeMust model seqan3::aligned_sequence.
Parameters
ref_seqThe reference sequence to compare against the query sequence.
query_seqThe query sequence to build the cigar string for.
query_start_posThe start position of the alignment in the query sequence indicating soft-clipping.
query_end_posThe end position of the alignment in the query sequence indicating soft-clipping.
extended_cigarWhether to print the extended cigar alphabet or not. See cigar operation.
Returns
A std::string representing the alignment as a cigar string.
Note
The resulting cigar string is based on the query sequence (query_seq).

Example:

The following alignment reference sequence on top and the query sequence at the bottom.

ATGG--CGTAGAGC
|||X |||X| |
ATGCCCCGTTG--C

In this case, the function seqan3::detail::get_cigar_string will return the following cigar string when printed: "4M2I5M2D1M". The extended cigar string would look like this: "3=1X2I3=1X1=2D1=".

See also
seqan3::aligned_sequence

◆ get_cigar_string() [2/2]

std::string seqan3::detail::get_cigar_string ( std::vector< cigar > const &  cigar_vector)
inline

Transforms a vector of cigar elements into a string representation.

Parameters
cigar_vectorThe std::vector of seqan3::cigar elements to be transformed into a std::string.
Returns
The cigar string (std::string).

◆ operator""_tag() [1/2]

template<typename char_t , char_t... s>
constexpr uint16_t seqan3::literals::operator""_tag ( )
constexpr

The SAM tag literal, such that tags can be used in constant expressions.

Template Parameters
char_tThe char type. Usually char. Parameter pack ...s must be of length 2 since SAM tags consist of two letters (char0 and char1).
Returns
The unique identifier of the SAM tag computed by char0 * 128 + char1.

A SAM tag consists of two letters, initialized via the string literal ""_tag, which delegate to its unique id.

using namespace seqan3::literals;
// ...
uint16_t tag_id = "NM"_tag; // tag_id = 10061
Provides the seqan3::sam_tag_dictionary class and auxiliaries.

The purpose of those tags is to fill or query the seqan3::sam_tag_dictionary for a specific key (tag_id) and retrieve the corresponding value.

◆ operator""_tag() [2/2]

template<typename char_t , char_t... s>
constexpr uint16_t operator""_tag ( )
related

The SAM tag literal, such that tags can be used in constant expressions.

Template Parameters
char_tThe char type. Usually char. Parameter pack ...s must be of length 2 since SAM tags consist of two letters (char0 and char1).
Returns
The unique identifier of the SAM tag computed by char0 * 128 + char1.

A SAM tag consists of two letters, initialized via the string literal ""_tag, which delegate to its unique id.

using namespace seqan3::literals;
// ...
uint16_t tag_id = "NM"_tag; // tag_id = 10061

The purpose of those tags is to fill or query the seqan3::sam_tag_dictionary for a specific key (tag_id) and retrieve the corresponding value.

◆ parse_cigar()

template<typename cigar_input_type >
constexpr std::tuple< std::vector< cigar >, int32_t, int32_t > seqan3::detail::parse_cigar ( cigar_input_type &&  cigar_input)
constexpr

Parses a cigar string into a vector of operation-count pairs (e.g. (M, 3)).

Template Parameters
cigar_input_typeThe type of a single pass input view over the cigar string; must model std::ranges::input_range.
Parameters
[in]cigar_inputThe single pass input view over the cigar string to parse.
Returns
A tuple of size three containing (1) std::vector over seqan3::cigar, that describes the alignment, (2) the aligned reference length, (3) the aligned query sequence length.

For example, the view over the cigar string "1H4M1D2M2S" will return {[(H,1), (M,4), (D,1), (M,2), (S,2)], 7, 6}.

◆ update_alignment_lengths()

void seqan3::detail::update_alignment_lengths ( int32_t &  ref_length,
int32_t &  seq_length,
char const  cigar_operation,
uint32_t const  cigar_count 
)
inline

Updates the sequence lengths by cigar_count depending on the cigar operation op.

Parameters
[in,out]ref_lengthThe reference sequence's length.
[in,out]seq_lengthThe query sequence's length.
[in]cigar_operationThe cigar operation.
[in]cigar_countThe cigar count value to add to the length depending on the cigar operation.

Variable Documentation

◆ add_enum_bitwise_operators< sam_flag >

template<>
constexpr bool seqan3::add_enum_bitwise_operators< sam_flag > = true
constexpr

Enables bitwise operations for seqan3::sam_flags.

See also
seqan3::enum_bitwise_operators enables combining enum values.

◆ is_type_list_of_sam_file_input_formats_v

template<typename t >
constexpr bool seqan3::detail::is_type_list_of_sam_file_input_formats_v = false
constexpr

Auxiliary value metafuncton that checks whether a type is a seqan3::type_list and all types meet seqan3::sam_file_input_format [default is false].

See also
seqan3::type_list_of_sam_file_input_formats

◆ is_type_list_of_sam_file_input_formats_v< type_list< ts... > >

template<typename... ts>
constexpr bool seqan3::detail::is_type_list_of_sam_file_input_formats_v< type_list< ts... > > = (sam_file_input_format<ts> && ...)
constexpr

Auxiliary value metafuncton that checks whether a type is a seqan3::type_list and all types meet seqan3::sam_file_input_format [overload].

See also
seqan3::type_list_of_sam_file_input_formats

◆ is_type_list_of_sam_file_output_formats_v

template<typename t >
constexpr bool seqan3::detail::is_type_list_of_sam_file_output_formats_v = false
constexpr

Auxiliary value metafuncton that checks whether a type is a seqan3::type_list and all types meet seqan3::sam_file_output_format [default is false].

See also
seqan3::type_list_of_sam_file_output_formats

◆ is_type_list_of_sam_file_output_formats_v< type_list< ts... > >

template<typename... ts>
constexpr bool seqan3::detail::is_type_list_of_sam_file_output_formats_v< type_list< ts... > > = (sam_file_output_format<ts> && ...)
constexpr

Auxiliary value metafuncton that checks whether a type is a seqan3::type_list and all types meet seqan3::sam_file_output_format [overload].

See also
seqan3::type_list_of_sam_file_output_formats